Explore Flipsnack. Transform boring PDFs into engaging digital flipbooks. Share, engage, and track performance in the same platform.
From magazines to catalogs or private internal documents, you can make any page-flip publication look stunning with Flipsnack.
Check out examples from our customers. Digital magazines, zines, ebooks, booklets, flyers & more.
Pre-made templates to create stunning publications in minutes
Here are eight reasons why you should consider choosing interactive, digital flipbooks instead of boring and static PDFs. Check them out!
- 2- ASSIGNMENT 3: INHERITED OR ACQUIRED? 1. A stretch of double-stranded DNA contains 1000 base pairs (bp) and its base composition is 58% (G C). How many thymine residues are in this region of DNA? If 58% is (G C), 42% must be (A T) [1M] . Since every A pairs with T on opposite strand, the number of A equals to T. 21% or 420 is T [1M] . (2000 x 0.21 = 420) 2. A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: a. a 3’ 5’ exonuclease that cleaves the 3’ ester bond of a phosphodiester linkage 5’ pdApdGpdT 3’ 5’ pdC 3’ [1M] b. a 5’ 3’ exonuclease that cleaves the 5’ ester bond of a phosphodiester linkage 5’ pdAp 3’ 5’ dGpdTpdC 3’ [1M] c. a 5’ 3’ exonuclease that cleaves the 3’ ester bond of a phosphodiester linkage 5’ pdA 3’ 5’ pdGpdTpdC 3’ [1M] 3. a. Do the two complementary strands of a segment of DNA have the same base composition? Why or why not? The base compositions of complementary strands are different [1M] . For example, if one strand has 100% A, the complementary strand has 100% T. However, since the two strands are complementary, the amount of (A T) must be the same for each strand, so is for (G C) [1M] . b. Does (A G) equals to (T C)? Why or why not? Yes [1M] . Complementarity dictates that for every purine (A or G) on one strand, there must be pyrimidine (T or C) on the complementary strand [1M] . 4. If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG, write the sequence of the complementary strand using the standard convention (i.e. according to the standard convention, the sequence is read from 5’ → 3’) . 5’ -CCGAATCCATGTTACGCGAT- 3’ [1M]
The cookies we use on Flipsnack's website help us provide a better experience for you, track how our website is used, and show you relevant advertising. If you want to learn more about the cookies we're using, make sure to check our Cookie policy
We use essential cookies to make our site work for you. These allow you to navigate and operate on our website.
We use performance cookies to understand how you interact with our site.They help us understand what content is most valued and how visitors move around the site, helping us improve the service we offer you.
We use marketing cookies to deliver ads we think you'll like.They allow us to measure the effectiveness of the ads that are relevant for you.